![]() ![]() She died as local sentiment had begun to turn against Elsa and her cubs, forcing the Adamsons to consider moving them. Elsa’s grave is in the Meru National Park. The life of Elsa and her cubs is covered in the book Living Free, published not long afterwards.Įlsa died prematurely of a form of babesiosis, a tick-borne blood disease similar to malaria which often infects the cat family. When Elsa was three years old, she brought three cubs of her own to show to the Adamsons, whom the Adamsons named "Jespah" (male), "Gopa" (male), and "Little Elsa" (female). Her efforts paid off, earning Elsa worldwide fame at the time, when her early life’s story was published in the book Born Free. Indeed, after sending the other two to a zoo, Joy was fiercely determined to give Elsa the education she needed to hunt and live in the wild. While Elsa lived in many ways like a domesticated pet when she was small, Joy Adamson, whom Elsa trusted the most, considered her relationship with Elsa to be that of equals. George and his wife Joy then adopted the lioness’s four-day-old cubs. George only later realised why the lioness had acted so aggressively towards him. Her story is told in several books by the Adamsons, as well as the 1966 motion picture Born Free.Įlsa and her sisters were orphaned on 1 February 1956 after George Adamson was forced to kill their mother when she charged him, in defence of her three cubs. Though her two sisters eventually went to the Netherlands' Rotterdam Zoo, Elsa was trained by the Adamsons to survive on her own, and was eventually released into the wild. 28 January 1956 – 24 January 1961) was a female lion raised along with her sisters "Big One" and "Lustica" by game warden George Adamson and his wife Joy Adamson after they were orphaned at only a few days old. ![]()
0 Comments
![]() toddler hairstyles black Venture Plan is an interface improvement addon for the covenant Command Table adventure missions which helps predict the success or failure of missions before you send them. Browse between thousands of projects, choose the ones you like and launch your. The CurseForge app has a user friendly interface that simplifies mod and addon management. Quickly and easily manage your addons and mods or discover new ones. CurseForge is currently in Beta - become an early adopter and help us hunt bugs before the Public release. Simple and Advanced combined - Bartender4 ActionBar AddOn. 60.8M Downloads Updated Created Sep 14, 2008. sankakuchan alison lohman nude the ultimate sweat football platinum edition into literature grade 11 answer key pdf roblox got talent piano sheet copy and paste unfortunately, the default blizzard nameplates leave a lot to be desired. Uber UI Source - Addons-World of Warcraft. ![]() Here’s a step-by-step guide to downloading WoW addons: Click on the “Download Overwolf” button at the top right and run the program to install the client. Addon managers are easy to use and will install addons into .Get the must-have addons. ![]() You can install WoW addons by using an addon manager or by installing them yourself. pretty drawing ideas Easily find the Classic wow Addon you are looking for by Choosing a category, Searching by name or expansion! If you need help downloading or installing addons .2022 Mey 23. is the repo for the World of Warcraft addon "WorldBossTimers" which is used to track and share timers for world bosses.Curse addon site. Download Install Description Files Images Source Localization Pages RelationsAddons Search. dan murphys online delivery sad dog commercial fumigation notice to tenants armed forces io freezenovaAddons 147,309,199 Downloads Last Updated: Game Version: 10.0.5 +2. All the top World of Warcraft Dragonflight addons, including auction house management, quest tracking, UI mods, …toledo blade coroner rulings 2022. payless furniture great falls mt The best WoW addons for Dragonflight 2023. Once actually installed, the app is very straightforward and works much like you'd expect - updating addons without Overwolf's overlay or other frills. gg slash command.Ignore the "recommendation" and download the standalone version if you only want to manage addons without all the extra Overwolf functionality. Instead, this addon adds two additional methods to surrender the match: Middle clicking the REFlex minimap button or LDB feed. That will not change in foreseeable future. Currently REFlex requires scoreboard access to create proper database entry. eaglecountryonline news Bug description Screenshots Questie & WoW versionMatches left using /afk will not be recorded. ![]() WoW: Die 5 beliebtesten Addons bei Curse – Februar 2023 Bug description Screenshots Questie & WoW version2023 Feb 20. ![]() ![]() ![]() With the use of available hacks and cheats online, you no longer have to plant more crops and trees or buy more chickens and cows to receive tons of coins and diamonds. With free coins and free diamonds, you can now expand your farm without spending much time and effort. The best way to put it is that if you don’t succeed right away, don’t give up. However, with the use of some tips and tricks, you can now become an incredibly wealthy farmer in a short span of time. Big Farm: Mobile Harvest is a game in which the players’ goal is to complete all levels as quickly as possible. Hence, the longer the time you attend to your farm, the greater amount of coins and diamonds you win. Certain large farm businesses must use an accrual method of accounting for. It will take time for you to grow and ripen your crops, and for the farm animals to produce eggs and milk. These special rules apply to farm NOLs for tax years 2018, 2019, and 2020. Also, the best part is that the online hack generator is 100% free and is always available anytime, anywhere.Ĭoins and diamonds are used to purchase new, cool items and that’s exactly why they are difficult to gain – you must harvest your crops and fruits, and gather dairy products every hour of every day. Find out what are the various ways to increase happiness, improve farming productivity and get more rewards from contracts with these useful Big Farm Mobile. In this online generator, you just have to open the website, input necessary information such as your username and the type of operating system you are currently using for the hack to connect automatically in the game. Big Farm: Mobile Harvest is meant to be played over a long period of time. When the player arrives there the farm is found in. It will be released into early access on Steam for Windows on August 20th The player gets gifted their grandpas farm. ![]() The goal is to prioritize upgrades that will have the most benefits for your game. Big Farm Story is a 3rd person farming-simulation game developed by Goodgame Studios. ![]() After that, you can upgrade the rest of the Market. How To Hack Big Little Farmer Game Offline Free Unlimited Coins And In 2012 muller was a relatively small but leading yoghurt brand turning over 368m and delivering an operating profit of around. It is less complicated than other game patches, in which you have to download files, install them and integrate them into the system. Prioritize income and experience gain when upgrading. Little alchemy 2 cheats is the best complete source of step by step cheats and walkthrough hints for little alchemy 2 2017. It is very user-friendly – it comes with a set of simple instructions on how to use the hack. This online generator is the best hack ever developed yet for the Let’s Farm game. ![]() ![]() ![]() This criterion depends on the downstream workflow. One critical point to keep in mind is that, whether to include the stop codon or not in the primer. The reverse primer was designed from the end of the sequence that we have added to APE.Ģ. Follow the steps mentioned below to get the reverse primer sequence.ġ. Whatever the issues are, with the help of tools like APE, designing the reverse primer is just a click of a button away. The other half of the problem is that we have to work with the template strand to design a primer for the other strand. Partly the problem comes from the fact that that way we communicate DNA sequences. The below illustration (Fig 2) gives a good idea of how the forward primer is designed and how it gets utilized in the PCR reaction.ĭesigning the reverse primer is a bit tricky process.It is a rule that the DNA sequences to be mentioned in 5’-3’ while the protein sequences to be mentioned from the N-C terminal. Please note that we are not mentioning it is as 5’- ATGGCATCCACACACCAATC-3’.So the forward primer sequence to order is “ATGGCATCCACACACCAATC”. As the sequence is from 5’ to 3’ direction, the forward primer can be directly ordered.Also, the sequence ends with ‘C’ which is beneficial as it wobbles less while polymerase works on extending the primer. So, this sequence can work as a forward primer. In the example mentioned above, the primer length is 20 nucleotides long, T m is 56.8☌ (~57☌), and the GC content is 50%.The parameters are updated in live, so you can select or deselect the nucleotides to match the required criteria.įor most cases, the preferable T m is between 55-62☌, and the GC content is 40-60%. You can observe several parameters of the selected sequence from the header section of the tools (red box). The forward primer is designed by selecting the nucleotide sequence from ATG until the primer parameters like GC-content and T m (melting temperature) match to primer designing parameters.Some of the tools like snapgene will show both the strands. Please note that only one strand of the DNA is represented here. The sequence of the gene is from 5’ to 3’ direction. It starts from the start codon (ATG) and ends with the stop codon (TAA). We copied the Dsup gene nucleotide sequence from the NCBI portal (mentioned above) and pasted it in the APE tool.The primer design steps remain the same even if you use a different tool.įollowing are the steps involved in designing forward primer: We are using APE (A Plasmid Editor) software to design the primers, which is free to use. To follow along, access the sequence of Dsup from this link. The following content focuses on demonstrating designing primers for different cloning methods. In case, if you take the complementary sequence and use it for primer designing (laying the sequence in 5’-3’), the reverse primer in the above example now acts as the forward primer. The forward primer creates copies of the 5’-3’ strand whereas the reverse primer makes copies of the complementary (runs 3’-5’) strand. Whereas Reverse primer uses the upper strand as a template and synthesizes the lower strand.Īlthough the names suggest they create copies of different strands, their names depend on the direction of the strand being used for amplification. The forward primer synthesizes the upper strand using the bottom strand as a template. One is called ‘forward primer' and the other one is called ‘reverse primer’. To amplify any DNA sequence, two primers are necessary. Dsup protein is a newly discovered gene that imparts resistance to UV radiation by coating itself to DNA. Tardigrades are fascinating animals with extraordinary abilities to cope with extreme conditions like the vacuum of space, high tolerance for UV radiation, high and low-temperature tolerance to begin with. The primer design is demonstrated using Dsup (Damage Suppressor) gene from tardigrade (water bear). This article demonstrates how to design primers (forward and reverse) for different types of cloning methods. ![]() ![]() Win + Ctrl + Spacebar Change to the previously selected input. Win + Spacebar Switch between different input languages and keyboard layouts. Win + Shift + Spacebar Cycle backward through language and keyboard layout. Win + Shift + Left arrow or Win + Shift + Right arrow Move an app or window on the desktop from one monitor to another. (Minimize the restored window or app on the second stroke). Win + Shift + Down arrow Restore the active desktop window or app or stretch it vertically downwards by maintaining its width. Win + Shift + Up arrow Stretch the active desktop window or app to the top of the screen by maintaining its width. Win + Home Minimize all except the active desktop window or app (restores all windows on the second stroke). Win + Right arrow Maximize the currently active app or desktop window to the right side of the screen. Win + Left arrow Maximize the currently active app or desktop window to the left side of the screen. Win + Alt + Down arrow Snap the currently active window or app to the bottom half of the screen. Win + Down arrow Restores the currently active window or app. Win + Alt + Up arrow Snap the currently active window or app to the top half of the screen. Win + Up arrow Maximize the window or app that is currently active. Win + Ctrl + Shift + number Open a new instance of the app located at the given position on the taskbar as an administrator. Win + Alt + number Open the Jump List for the app pinned to the taskbar in the position indicated by the number. ![]() Win + Ctrl + number Switch to the last active window of the app pinned to the taskbar in the position indicated by the number. Win + Shift + number Start a new instance of the app pinned to the taskbar in the position indicated by the number. If the app is already running, you can use this shortcut to switch to that app. Win + number Open the app pinned on the taskbar in the position indicated by the number. Win + Ctrl + F Search for PCs (if you’re connected to a network). Win + Pause Display the System Properties dialog box. Win + comma (,) Displays the desktop temporarily until you release the Windows logo key. Win + period (.) or Win + semicolon ( ) Open Windows 11 Emoji Panel. Win + Y Switch input between your desktop and Windows Mixed Reality. Win + Shift + V Set focus to a notification. After that, the Win + V shortcut keys will launch the Clipboard but not display the Clipboard history. Simply launch the Settings app and go to System > Clipboard, and turn off the Clipboard history button. Note: You can turn off Clipboard history in Settings. Win + T Cycle through apps on the Taskbar. Win + Shift + S Used to take a screenshot of the entire screen or a part of it. Win + Alt + R Used to record the video of the game that you are playing (using the Xbox Game bar). Win + P Used to select a presentation display mode. Win + N Open the Notification Center and Calendar. Win + Shift + M Restore all the minimized windows on the desktop. Win + L Lock your PC or switch accounts (if you have created more than one account on your PC). You can use this shortcut to share your device screen on your computer. Win + I Open the Windows 11 Settings app. Win + G Open Xbox Game Bar when a game is open. Win + F Open Feedback Hub and takes a screenshot. Win + Ctrl + C Toggle the Color Filters (you have to enable this shortcut first in Color Filter settings). Win + B Set focus for the Show hidden icons dropdown menu. Keyboard Shortcut Action Win key Toggle the Start Menu. The following table lists the tasks performed by Windows logo keyboard shortcuts in Windows 11. ![]() 1] Keyboard shortcuts with Windows logo key Keyboard shortcuts for Virtual Desktops.Windows 11 Settings app keyboard shortcuts. ![]() Keyboard shortcuts with Windows logo key.We will list here the following keyboard shortcuts in Windows 11: Microsoft has introduced some new keyboard shortcuts in Windows 11.Ĭomplete list of Windows 11 Keyboard shortcuts Though both Windows 10 and Windows 11 operating systems have plenty of keyboard shortcuts that users can use to do tasks quickly, there is something new in Windows 11. In this article, we will talk about the Windows 11 keyboard shortcuts you should know. The purpose of keyboard shortcuts is to increase productivity by performing quick operations. Keyboard shortcuts are used to perform various tasks in a Windows operating system. ![]() ![]() ![]() This can be handy when you need to evaluate the same expression multiple times. If you call Python’s eval() using a compiled-code-based input, then the function performs the evaluation step and immediately returns the result. If you use compile() to compile the expressions that you’re going to pass to eval(), then eval() goes through the following steps: If you want to process the compiled code with eval(), then this argument should be set to "eval". mode specifies which kind of compiled code you want to get.If you’re going to use a string-based input, then the value for this argument should be "". filename gives the file from which the code was read.This argument accepts normal strings, byte strings, and AST objects. source holds the source code that you want to compile.The details of how to use compile() are beyond the scope of this tutorial, but here’s a quick look at its first three required arguments: This is a built-in function that can compile an input string into a code object or an AST object so that you can evaluate it with eval(). To compile the code that you’re going to pass to eval(), you can use compile(). You can also pass compiled code objects to Python’s eval(). In the above example, you try to evaluate an incomplete expression ( "5 + 7 *") and get a Synta圎rror because the parser doesn’t understand the syntax of the expression. You can’t pass an expression to eval() that violates Python syntax. > # Incomplete expression > eval ( "5 + 7 *" )įile "", line 1 5 + 7 * ^ Synta圎rror: unexpected EOF while parsing Take a look at the following example in which you try to execute an if statement using eval(): If you try to pass a compound statement to eval(), then you’ll get a Synta圎rror. A statement is either an expression or one of several constructs with a keyword, such as if, while or for. On the other hand, a Python statement has the following definition:Ī statement is part of a suite (a “block” of code). Assignments are also statements, not expressions. There are also statements which cannot be used as expressions, such as while. In contrast to many other languages, not all language constructs are expressions. In other words, an expression is an accumulation of expression elements like literals, names, attribute access, operators or function calls which all return a value. The Python documentation defines expression as follows:Ī piece of syntax which can be evaluated to some value. The name expression for the first argument to eval() highlights that the function works only with expressions and not with compound statements. To evaluate a string-based expression, Python’s eval() runs the following steps: By default, eval() has access to global names like x in the above example. When you call eval() with a string as an argument, the function returns the value that results from evaluating the input string. If you want to get the code for this application, then you can click on the box below: With this example, you’ll apply everything you’ve learned about eval() to a real-world problem. How eval() can make your code insecure and how to minimize the associated security risksĪdditionally, you’ll learn how to use Python’s eval() to code an application that interactively evaluates math expressions.How to use eval() to dynamically evaluate arbitrary string-based or compiled-code-based input.In this tutorial, you’ll learn how eval() works and how to use it safely and effectively in your Python programs. This function can be handy when you’re trying to dynamically evaluate Python expressions from any input that comes as a string or a compiled code object.Īlthough Python’s eval() is an incredibly useful tool, the function has some important security implications that you should consider before using it. ![]() Python’s eval() allows you to evaluate arbitrary Python expressions from a string-based or compiled-code-based input. Watch it together with the written tutorial to deepen your understanding: Evaluate Expressions Dynamically With Python eval() ![]() Watch Now This tutorial has a related video course created by the Real Python team. ![]() ![]() status monitoring and more detail for all your disks is only a click away. See used and free space for multiple disks in your menubar. Opening the menu shows a list of the apps using the most memory, and other useful info.Ī realtime graph to keep on top of what’s being sent and received for all network connections, including a bandwidth breakdown for the top 5 apps. Memory stats for your menubar as a pie chart, graph, percentage, bar or any combination of those things. Plus, GPU memory and processor usage on supported Macs, and the active GPU can be shown in the menubar. CPU usage can be tracked by individual cores or with all cores combined, to save menubar space. Realtime CPU graphs and a list of the top 5 CPU resource hogs. ![]() Our menubar and dropdown menus are now localised for Arabic, Catalan, Chinese (Simplified), Chinese (Traditional), Croatian, Czech, Danish, Dutch, Finnish, French, German, Greek, Hebrew, Hungarian, Italian, Japanese, Korean, Norwegian, Polish, Portuguese, Portuguese (Portugal), Romanian, Russian, Slovak, Spanish, Swedish, Thai, Turkish, and Ukrainian. Daylight is now indicated in the clock face (it even fades near sunrise and sunset). Improved GPU monitoring, including active GPU in menubar.Ī vastly improved time menu, with current time, sunrise, noon, sunset, dawn, dusk, sun azimuth, sun altitude, light map and more for over 120,000 cities. Wi-Fi stats, including channel, signal to noise ratio and many more. Upload and download activity is also shown per-app, making it far easier to track down the biggest bandwidth hogs.įar more detailed network information, including router address, subnet mask, DNS and MAC address. IStat Menus 5 features read and write disk activity on a per-app basis. ![]() ![]() Meanwhile, Chinese language films are hot. But their longest streak this year is 2 weeks on top, and they’ve placed first in only 3 of the past 16 weeks. For 23 straight weeks in 2012 Hollywood films reigned at the top of China’s box office. The huge box office bonanza that Hollywood movies enjoyed a year ago in China is now looking more and more like a cruel head fake. Every major studio has now had at least one disappointing release in China in the past three months, and none has had a breakout success. Oz the Great and Powerful debuted to a distressingly low $9 million in China this weekend, becoming the tenth straight U.S.-made film this year to falter in PRC theaters. For info on China Pooch email Robert Cain for China Film Biz Because these tools can automatically analyze & recognize the files which need to be deleted, and save a lot of time that you can spend working on your Mac.Follow me on Twitter Sina Weibo or connect with me on LinkedIn. 2> If you are a newbie to macOS, then a third-party removal tool is suggested.1> If you are a sophisticated user of macOS and know well of its operating theory, then you can consider manual removal.Manual Removal & Auto Removal - How to Choose? ![]() 4> After the analysis, click “Complete Uninstall” to perfectly remove SaveHollywood 2.1.3> MacRemover will analyze the installation information of SaveHollywood 2.1.2> Run it, select SaveHollywood 2.1 in the list of installed applications, then click the “Run Analysis” button.So you may ask: is there a simpler way to remove SaveHollywood 2.1? Remove SaveHollywood 2.1 through MacRemover’s One-Click Uninstall Features Download Mac App Remover Most users, however, are not tech-savvy enough to fulfill such tasks. In general cases, macOS doesn’t display the hidden files/folders as default, but you can still eliminate them by using the “ls -al” and “rm” commands. Then you need to make sure whether they belong to SaveHollywood 2.1. If you understand the above knowledge, you’ll know how to completely remove SaveHollywood 2.1 by locating and deleting the associated files/folders.How to search for files on macOS? Through either the Finder or the Spotlight. During the use of an macOS App, more files can be generated in different folders: Since these file types run code when opened, unknown executable files, such as those received as e-mail attachements, should not be opened. macOS applications, scripts, and macros are all considered executable files. Unix executable filesĮxecutable files contain code that is run when the file is opened. "Kext" stands for Kernel Extension kext files "extend" Mac OS X's kernel, the core part of the operating system, by providing additional code to be loaded when your computer boots. Kext files are essentially drivers for Mac OS X. Static libraries are collections or archives of object files. The kind of library that becomes part of an app’s executable file is known as a static library. A static linker collects compiled source code, known as object code, and library code into one executable file that is loaded into memory in its entirety at runtime. When an app is linked with a library using a static linker, the code that the app uses is copied to the generated executable file. Most of an app’s functionality is implemented in libraries of executable code. The system loads them into memory as needed and shares the one copy of the resource among all applications whenever possible. Multiple applications can use all of these resources simultaneously. framework filesĪ framework is a hierarchical directory that encapsulates shared resources, such as a dynamic shared library, nib files, image files, localized strings, header files, and reference documentation in a single package. For example the ist would contain your bookmarks. They contain the preferences for a particular program. Plist files are the Mac version of preference files. Download Mac App Remover A macOS App contains several types of files, among which these 5 are relatively important: 1. And since it could be a bit complicated to fully remove SaveHollywood 2.1, I’ll explain the how this application is installed and how the system manages the files under the following subtitles. Meanwhile you may still be using the older version and getting on the path to join them, so this article can be quite helpful - before you install the latest version of SaveHollywood 2.1, a complete removal is suggested. Lately the update of SaveHollywood 2.1 has been released, supporting the latest macOS. Properly Remove SaveHollywood 2.1 on macOS - Correct Uninstall Instruction ![]() ![]() It features cel-shaded animation and actual voices from the cast of the original prime-time show. ![]() Xbox One is unlisted because the console never released any Simpsons games. View their recently played xbox games, achievements and more. The Simpsons Game is a 3D platform game that was released for the Xbox 360, PlayStation 3, Wii, PlayStation 2, and PlayStation Portable it was also released as a 2D platform game for the Nintendo DS. Más abajo tienes nuestro FAQ oficial para resolver tus dudas. An updated list of all Xbox Simpsons Games for Xbox 360 and the Original Xbox. Its original release date was October 30, 2007. From the writers of The Simpsons, comes the city building game that lets you create your own living, breathing Springfield When Homer accidently causes a meltdown that wipes out Springfield. ![]() La retrocompatibilidad es un servicio totalmente gratuito, con tener tu copia del juego que haya sido adaptado a Xbox One, solamente tendrá que ponerlo en tu consola, descargar y jugar, así de sencillo. It fits very well into 'The Simpsons' universe. ![]() ![]() ![]() Continued abuse of our services will cause your IP address to be blocked indefinitely. Please fill out the CAPTCHA below and then click the button to indicate that you agree to these terms. If you wish to be unblocked, you must agree that you will take immediate steps to rectify this issue. If you do not understand what is causing this behavior, please contact us here. If you promise to stop (by clicking the Agree button below), we'll unblock your connection for now, but we will immediately re-block it if we detect additional bad behavior. Overusing our search engine with a very large number of searches in a very short amount of time.Using a badly configured (or badly written) browser add-on for blocking content.Running a "scraper" or "downloader" program that either does not identify itself or uses fake headers to elude detection.Using a script or add-on that scans GameFAQs for box and screen images (such as an emulator front-end), while overloading our search engine.There is no official GameFAQs app, and we do not support nor have any contact with the makers of these unofficial apps. Continued use of these apps may cause your IP to be blocked indefinitely. This triggers our anti-spambot measures, which are designed to stop automated systems from flooding the site with traffic. Some unofficial phone apps appear to be using GameFAQs as a back-end, but they do not behave like a real web browser does.Using GameFAQs regularly with these browsers can cause temporary and even permanent IP blocks due to these additional requests. If you are using the Brave browser, or have installed the Ghostery add-on, these programs send extra traffic to our servers for every page on the site that you browse, then send that data back to a third party, essentially spying on your browsing habits.We strongly recommend you stop using this browser until this problem is corrected. The latest version of the Opera browser sends multiple invalid requests to our servers for every page you visit.The most common causes of this issue are: ![]() The Buggy in the second base can sometimes spawn in the colours of the General Lee.Your IP address has been temporarily blocked due to a large number of HTTP requests. Their base contains several Marine and Medic units, a Barracks, several Supply Depots, and some resource pickups. Commanders up to Level 5 Kerrigan, Raynor, and Artanis are completely free, and all other Commanders are free up to level 5. Versus Mode Access Unranked and Versus AI for free unlock Ranked with 10 first wins of the day in Unranked or Versus AI. By reaching a beacon at the entrance of their base, you get all their surviving units to join you. The award-winning StarCraft II: Wings of Liberty story campaign is free in its entirety. The outlaw units (yellow) are under attack by several waves of Dominion marines. The Outlaws: There is an outlaw base to the west of your starting point.However on Brutal the AI aggressively targets your Medics, so you may want to stay closer to a 3:1 ratio, and make sure to keep your Medics behind your Marines. You can run your army in with a sacrificial Marine in front to avoid splash damage once you're at melee distance you can take it out safely.Ī 4:1 Marine:Medic ratio is solid, but do note that as your Marines are more likely to die than Medics, you'll eventually only have to replace the former. The Tank: On Brutal difficulty there's a Sieged Tank near the right side of the mineral line. The Hellions: Split your infantry up to avoid splash damage. Focus down the Factory first as the Hellions are quite lethal and be wary of the following threats: Keep pumping Marines and Medics and when you have a large enough number (20-30+) head north and take out the base to complete the mission. Take out the attackers with the rebels' help and rescue the mini-base. When you have a small Marine and Medic force of about 10 units, head left down the road which will trigger an attack on the rebel base. After you've built a small force, you can take on the units guarding the mine to the north and pick up some more resource containers without taking any losses. It is recommended to float your Barracks up onto the road before you build a Tech Lab so that you reinforce quicker. ![]() Move north out of your base with your Marines immediately to collect the resource containers. Send your SCVs to mine and add Supply Depots and Barracks as necessary (you will want at least 3 Barracks) whilst you add Marines, SCVs and Medics. Similar to a Medivac, she can heal friendly biological units. This unit can be built from any Barracks with a Tech Lab add-on and costs 75, 50. In this mission the Medic is made available. ![]() |